Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhva15b01
Contig Information
Length 845 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva15b01   
Homology (BLAST) Top Hit POT family protein [Zea mays]
Score 607
Evalue 1.56901e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhva15b01
AGTTTATTACAAAGCCAAGTGCCACCCGGCAGATAAACTAAAACGTAAACAGATACTCCCTCCATCCCAAAATACTTGTCGGAGAAATGGATAAAATTGG
ATGTATCTATAACTAAAATACGTCTAGATTCATTCATTTCCCCGACAAGTATTTTCGGACGGAGGAAGTATCATAAACCAACCAAAGATACATACTCTTC
AAATACTACCACATAAGTGACCACAGTCCAGTGGAGTAACAAAAATGTTTGCTGATCATCCACTACATCGAATAATCGATGCATAAATACATCCACTGCT
AATTCCAGGTTGTCACTCTGCACGGTCTCTTTTGTCCTTGTAGACGTAGGATCTGGCGAAATAGATGTGGAGCACAAGCTCGGTGGCGCTGAGGCCGGCG
AGAACCCAGTAGAAGTAGTCGAGGTGGGCGCGATTGAGGTTATCAGAAAACCAGCTGTCGCCATCACCGCTACGGGTGATGCGGTCAATGAGTGAAATGA
GAGCGCCACTTATGAAGCCACCGACGCCAATCACACTGCAGTAGAGCGCTATCCCAAGGCTACGAAGCTCTTTAGGCATCTGGTCATAGAAGAACTCCTG
CATCCCGACTATCACAAACACATCTGCCACCCCGACCATCATGTACTGTGGCACTAGCCATGCCCAGCTCATCGGCACCGTCGCACCACCATCGTCAACC
AGTTCATGTTGTCGTGCCGTCTCTAGCCTCCGAGCTTCCACCAACGCCGCCACACACATGGCAGCTAGCGACACAGCCATGCCCGTGCCCTATTCGTTGC
AGGAGCGTTAGTCCTGATGGGATGCCTGTCACGCACACAATGCTG
page-top