Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhva15b11
Contig Information
Length 837 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva15b11   
Homology (BLAST) Top Hit hypothetical protein OsI_04091 [Oryza sativa Indica Group]
Score 967
Evalue 2.35576e-107
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhva15b11
CAGCTATACACTGACGGTGGTTAATTGCACTTCAGCGTTCGTCTTTCATCAGTATTTACAGTACATCACAAGTGAGAGAAAACCAGTTATATATATTCCC
TTCATATCTGCCTCGAGCAAGCTGCAGGCTGCAACAGCACTTGGATCATCTGCCTCCCTTCACAATTCTAAATTGGTCCCGGATCTCCGTTGTGCCTGAG
CTTACAAACTGAACCAACACACTGGTCTTAGTGGCGTGCACCCTGGCATAGCCAAACTCTGAAATCCTCGACACGCTCCAGCTCTGCGGAATGAGAGAGA
AGCCGTCCAAGCTGAACCCTCCTGCTCCAACGATGGCATGGACTGGCGCAGTGTAGTTGCTGTTATCGTAGGTGTCGATGCCACTGGCATCCTTCCTCGG
CATGCCTCTGCACTTGCCCTTGTAAACTGCGCAGGTCCTCTCGTAGTTGTGCACATGGCCGAAGAAAACCAAATCCACCTTGTTGGTGAGCAAGAGTGGC
TCCACAGAGGCAACAAAGTCCGGGTCCACGCTGGGAATTATGCCCACATTCGATGAGTACATTGGTCTATGCCCAATGAAGATCACCCATGGAGTCCTGG
ATCGATCGACCGACGACAAATCCCTCTCCATCCAGTTATATTGCTCCGACTTCTCCGACCAGGAATGCTCGGTGGACATGAAGATGAAGTGGACGCTGCC
TTGCTCGATGGAATACCACGGCTTGTCCTTGCCAGCAGCGGGCATGGGGAAGTAGGACTCGTAGGCGACGCCGCATTCGCCGCCCGAAATCCGGGGTCAC
GTACACAGACCCAGACCCTGCATAATCCCTCTCGTGG
page-top