Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhva15b20
Contig Information
Length 828 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva15b20   
Homology (BLAST) Top Hit Os10g0412100 [Oryza sativa (japonica cultivar-group)] >gi|78708623|gb|ABB47598.1| endonuclease/exonuclease/phosphatase family protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|78708624|gb|ABB47599.1| endonuclease/exonuclease/phosphatase family protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639196|dbj|BAF26501.1| Os10g0412100 [Oryza sativa (japonica cultivar-group)]
Score 923
Evalue 9.93362e-98
Total Hit Count 407
Registered year 2003
Contig Sequence     [ Download ]
>rwhva15b20
AAGGGGCAGCTTAAATATCATGAAGTTGAAATGTAAAAAGGGTAATAATCAACACTACACGAGGCTCTCTTTTCCCAAGGTTGTTTCCTAAGACTGATTG
ACTGCTTCCCCGGCGATATGATCGCGTCTGCCCCTCCTCAACTTCCACCTTCCACCATGGAAGTTAAACCTCCAGCATGGACGCTGATGTGACCATCTAA
GGCATCATCGTCTGATTCTAGGCTTGCAACGGAATTCTGCTAAAAGTGCTATGTGATCTGATGACCATTCAGGTGAAGGGAGAGCAGTGTCTTTTCTTAA
GCTCTCCTCATCCAGAAGCTCCAATAAAGACTCCACTGACAACGAATCCGCTGTGTAAAATATGTAATCAACAGTACCAGTGAAATCTCTTGTGCAATTT
GTGAAAAGTGGTTCATTTGTTCCTGAGTCCATCCTCCTCCGCTGGTGCTCCAAATCATAACCGACACCTACCATCCTTGCAAATGAAGAATATGCACTGA
CCAGAGGAAGCTGATGTGTCAGCTTGCTCACAGGGCGTAAAATTCCAAGGGGGTCAATGGCCAGATCTGGATGCAATTGATCAACTTTGCCTATCGCAAG
AAGCCCGTGTGGAGTACTCCCAGGGATTGAATTGAAATCCCCACAGACCAACATTGGAATGTCCGCACTGTTAGCTATCTTTTCCAATCCTTTCAAAAGT
GTTTGAACCTCCCATAGCTTGACATCTTTGAGATCTTGGTGGACATTTACATGTGTATTGGCCACACAAAGGAGCTGTCTTTTACCAGGGTTTTCAGTTC
CTTGGNTGCCAAATTTGGGCTTCTAAGA
page-top