Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhva15c11
Contig Information
Length 889 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva15c11   
Homology (BLAST) Top Hit olfactory receptor [Rana esculenta]
Score 84
Evalue 2.17188
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>rwhva15c11
ATTTGGTCGATATATGCTCGCCCACTAAAAATATAAACCAAGTGCATATTAGTTGCTAGATTGTTTATATACAACCTAGAGTGAAGTTTTCTGGCCCTGT
ATTGCGAAATGCCTTTCCCTTCAGAATTTAAATTCGTTCACAAAGTTCTATGTCTTGCTCCCACTCAACTCCCTTCCTAGCAATCACCATGTCCATTTCC
CCACACCTAAGTGCCACCTGAAATACAAGAAGATAAAGTATGATGACGATCTTTCTCATGCTTGGCTACTTCTCTGTCTCATCCTCATCTGTGCGCTTGC
AATAGCTTCCTTTTTATGTATGCATTTCTTCCTAGTCCAGTGAATAGTTGCGAGCTCTTGTTGTTTCCTACAAGAATTGCTTACATGTGAAGGGCACGCC
TTAAATCAAGGAGGACATGTGACAATCGCAACATCCCTGCAACCCACACTCATTATGTGGATAATTGTGCAATTGAATTTGTTCTGGGCTTCACATCGAC
CAATGTCTCGGCAGGGGTGAAGGGAATGGGAAAAGTTTAATGTAAACGAAACACAACTCAGAATGAAAAAGCAACAAACACCCCATGAATCTAGCTTTGA
ATTCACCTTATTAGCGCTATCACTTTGTCATTTCTGTTTATAGGGCTCAAGAAGTTTTAAGACCAGGGATACTCTGCTCCAGAACATCTCAAGTATATGT
ATATACAAGAACTACATCATGCTATATTATTGTTCCCTAAAAAGAATAAGGAATAAAGTAGTAAAAAAGCTAAGCTTAGATTCATGGCTCCAACTTTATC
CAGAACATCTCAAGTATATGTATATACAAGAACTACATGCCCATCATATGNGGTACTATATAGAAAAAATGACCTTCAGTCCTCAAGTA
page-top