Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhva15d22
Contig Information
Length 910 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva15d22   
Homology (BLAST) Top Hit serine/threonine kinase [Sorghum bicolor]
Score 622
Evalue 2.54442e-73
Total Hit Count 377
Registered year 2003
Contig Sequence     [ Download ]
>rwhva15d22
AATGGGAACGAACGAAATGATGACCGGCCGATGTGAGTTTACAAGCATATTCGGCTAAATGTTTGCGAATTCCTGATTGCATTGTTCCAAAGTGAACTCG
ATACGACTTGCGAAAACCCACATGCCTAATATACAGCAAAACCTACTTGAATGTGCTTGACTTAAACTGTTCCAAGAAGTCTCTCAAAATGCAGCATATA
CAACACCAGTGGAGGACAAGCACAGCTGACAACAGGGCTATCCATCGGTACTTACAAAATGCGGTGAACAATTTTTTCTTGATCCAGCTCCTGAGAATGG
ATCAACTCAGGAGGAATGGGATGCTAATAGTTTACCCATTCCCCCTTCTCCCAAGCTGCTGCTAGGAAGGTTGGATCTGAAGATCGTCGGATTTCCAAAC
AACGTCCTTCAAGGTGTTTGAAAGGTTCTTGTAGAACTTGTGAAATTCTAGAGTGTCACCTTTTGCTTTGCGAACTTCAACCATATGAAGAGAAGGTCCG
ACTCGCAGTATCTCGGTAGCAACATTGAGGTTCCCCTTCCTTCCTGCTTTTACCTTTTCTAGTCTCAGCTTGTAATTTTTCTTCTGAATATCAAATCCTA
GAGGCTTTGCAGCTTCTTCAATCTTGCGGAGAATTTCTTTAGGCGAGCTTTTAGATGTAAACCTTGTTTCTCTTTTAAATTCCTGCTCAGAGTCGAATAA
ATTTCCAAGATTGAGGCCTGCTGACATAGAAATCAGTTCAAATGCATTCAGAGCTACTGGTTCTTCTTCTTTCTTTTCTGTTACATGGTGCTCTTCTGAA
TCATTGAAAAACAGCATCCACATCATCCAGTGTTGTGTCATACTTCTCATCAAACTCCGCACGCTTGTAACCCTTTCTTGAACCACTCATCTTCTAGCAT
TTCTTGAACT
page-top