Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhva15e22
Contig Information
Length 877 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhva15e22   
Homology (BLAST) Top Hit hypothetical protein OsJ_004891 [Oryza sativa (japonica cultivar-group)]
Score 1010
Evalue 8.91541e-108
Total Hit Count 165
Registered year 2003
Contig Sequence     [ Download ]
>rwhva15e22
GTTTTCGCAAACACAAGCTATTCCAGTTTACTCAGAACATCCCATAAAATTCTTCGGACCGACAAAAAAGGAAAAGCCAAAACTTATGTCAAGTCTGACT
TACATATGCCTATAGCAACAGACAAATCAATACAATCAAAAATGGTATTACATGGTACATATGGGGACAGGTTGCTAACTACGGGGAATGTCGAGCGCGG
TGGAGTCATTGAGCACCTTGCGGGCACGCCAGTAGATAGCATTTGATGTTTCTGATGTTCCCACCGTCAACTCCATATTGTAGTACTTCCTCCATAGTTC
CCTTTCTTGTGGATAGAGGCTGATTGCTGAGTCATAGAGCTTGCGCGCGTTTACAAGGCCATCATTGTTTCCGATTGATGCAAGGTTAGCTTCCAGCTCT
ATGCAGAACTGGAAGAACTTAAGACTGGGGCGCGGTAAAGCCAAAAATCTCTTATACATTTTCCTAGCTTGCTTAATACCATCTTTCTGCAAAACCCATC
CGATAAAAGCTGAAGAGACTGAAGCTCCACAATCACTCCCACCAGCTGAACTTAATGATAGCATTGCACATTTCACCAGCTTTTCGAAATATATCTTTTC
ATGAGAAAACAATTTCATCGCCGTATGCCAGAGTCCCTCAGCCTTGGTTATGGATAACTTCGGAAGTACAATATTAAATAAATCAAACAGAGAACTTAGA
TTCTCCTCACTAAAGGAAGCACTGCCGGTAGCAGTAGCAAGTGACTTTATCTCTATAGAAGCTCTCAAGTTCCACAGATTTGCAGCCTGTGAAAGAGGAC
CACTGCAGAGCTTTTCTGCGAGATTCTTANCTTCCTCCAATCTTTCAGGTGCTTCCTCCGACCTTCCNAGTTTCAAA
page-top