Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whva10i10
Contig Information
Length 613 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva10i10   
Homology (BLAST) Top Hit Os04g0402100 [Oryza sativa (japonica cultivar-group)] >gi|21740628|emb|CAD40786.1| OSJNBb0012E08.10 [Oryza sativa (japonica cultivar-group)] >gi|113564263|dbj|BAF14606.1| Os04g0402100 [Oryza sativa (japonica cultivar-group)] >gi|215697270|dbj|BAG91264.1| unnamed protein product [Oryza sativa Japonica Group]
Score 840
Evalue 2.23552e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whva10i10
GGCCGGTTGCGCTTGCAGAGAGATCGGGTCGGGGAGGATGACGACGGGAGGGCGCGCGGTGCTCCTACTGCCGCTTCTGGTGGCCTCGGCGCTGTTCGCG
CAGATCCGCGCGTCGGATCCGCTGTTCCACGAGTCCTTCGACGAGGGCTTCGAGGGGAGCTGGGTCGTCTCCGGCAAGGAAGAGTACTCAGGTGTATGGA
AGCACGAGAAGAGTGATGGCCATGAAGACTATGGTCTCCTTGTCAGTGAGCCAGCCAGGAAATATGCCATAGTCAAAGAGCTTGATAGCCCTGTTACTTT
GAAGGATGGGACAGTTGTCCTGCAGTTCGAAGTGAGGCTTCAGAATGGCCTCGAGTGTGGAGGTGCTTATCTTAAGTACATTCGCCCTCAGGAGGCTGGA
TGGGATGCCAAGGAATTTGACAATGACACTCCTTACACAATTATGTTTGGTCCTGACAAGTGTGGTTCAACGAACAAGGTTCACTTCATCCTGAAGCACA
AGAACCCCAAGACTGGCAAATATGTTGAACATCACCTCAAGTCCCCACCCTCTGTCCCATATGACAAGCTCTCTCATGTCTACACGGCTATCTTGAAGCC
GGGATAACGAGGT
page-top