Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1995
Contig Information
Length 763 bp
Tissue Seed DPA20
Clones 4 Clones [Download: CSV  ,  FASTA ]
whdp16c01    whdp19h04    rwhdp16c01    rwhdp19h04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0569200 [Oryza sativa (japonica cultivar-group)] >gi|77556849|gb|ABA99645.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113649578|dbj|BAF30090.1| Os12g0569200 [Oryza sativa (japonica cultivar-group)]
Score 465
Evalue 1.08329e-44
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1995
ACACACCAACGACGGATACAGAGCTGACGACATGCAGTTCATTGCACGGCCATGAAACATCTCTAGCCACGCATTCACCACCGCAACTACTAATTGAACA
GCAAATCCGACACAACGCGACACGACAGTACAATAGCTCCTTGGAGCAGATGATTAACTAACTAGCAGCTGCAATACGACTAGGATCACCGAGCTGCAAA
CTTATTAAACACACCCATCAGCTGGATCTAGGGGTTGTAGAAGACGATCTTGATCTCGTCGACGCCGTGGCACTTGCCGCCGGGGACGGAGTGCTCGAAG
CAGTGGCCGCCGCTGTTGCAGCCGGCGGTGGGGCAGTGGTCTTTCAGGGGGTGGCCGTGGGGGGTGATGGAGACACGGATGGGCATGTGCGACTGGGCGG
TGCTCACCTGGTACCACGCCCCGCCGTCGTACCCGATGTGGAACTCCGTCACCACGGCGTCCTGCACCTTCACGCGCCCCGTCCACGAGCACACGTCGTA
CGACACGTGGGTGCCGTGGCGGAGCAGGAAGCCAGGGCTGTAGAGGAGCTTGCTGTTGGCCAGCGGCTCGATACCGAGGTAGAGGTCCTTGCCGCACAGG
TTCTGCACCGTCACCTTGCGGCTCGGCTTGCAGTTTTGGGGATCCTGACCGGCGGCGGACATGGCAGTCGCTGCCAGCGCCACGGCGAGGAGGAGAGCCG
CCAGGGGCTTGGAGAACGCCATTGGCTGCTTGGAGTGTTACTCGCTGGTTAGGAGTAAGAGGA
page-top