Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1967
Contig Information
Length 628 bp
Tissue Seed DPA20
Clones 4 Clones [Download: CSV  ,  FASTA ]
whdp10f19    whdp14b20    rwhdp10f19    rwhdp14b20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit early nodulin protein [Brachypodium sylvaticum]
Score 360
Evalue 1.0879e-32
Total Hit Count 51
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1967
TCATCTTGCCTCACACACTTCACTGCTAGCTACTAGTAATTCACTTCCTTGGGTTCTCGTGCCACCGAGCTCTCTCCCGCGAAGATGTCGACGGTGACCC
CTGCCTACCTCGACCAGAGGCTCGCCGCCGCCAAGCGCTCCTCCAGAGAGGCCGCCATGGCGGGAGCCAAGGCCGCGGCCGTCGCCACCGTCGCCGCCGC
AATCCCCACCCTGGCGAGCGTGAGGATGCTGCCGTGGGCGAGGGCGCACCTCAACCCAACCGGGCAGGCGCTCATCATCTCCACCGTCGCCGGGATGGCC
TACTTCATCGTCGCCGACAAGACCATCCTCTCCATGGCCAGGAAGCACTCCTTCGACGACGCGCCAGAGCACCTCAAGAACACCTCCTTCCACTAATTAG
ACTGTAATAACAGATCCATTAGCAGTGCGCGATAAGCTGTGTGCGCCAGCCCGTACGTGTCTGCTGAAAGATGGTGTGTAACGTTCAGCACTTACCCGAG
GCTTGCAGACAGTCAGTGGTGTGGTGTACTGCTCTTCTCTGCGTGCAAGGACTTGTCTGATCAAGTAATCATCATGTATCCAGCCAGTAATCTTGAACTA
ATAATAACTTGCATTTGCAAAAAAAAAA
page-top