Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whva11g19
Contig Information
Length 726 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva11g19   
Homology (BLAST) Top Hit hypothetical protein OsI_18471 [Oryza sativa Indica Group]
Score 672
Evalue 9.82584e-69
Total Hit Count 165
Registered year 2003
Contig Sequence     [ Download ]
>whva11g19
ATCGACCAGATTTGGCAGTAACAGACTTCAGGGGAGCTCAAGAACTAAGGGCTGATCTTCGCTCTTATCAAGGTTTGGTGCGTGCTTATCTAGCACTTTC
CAAATGCAAAGATGCATTATTCACTGCACGTGAAGCAATGAAGGTTATGCATCAGTCTGCAAAAGCTCTCAAGCTAGTTGGTGATGTGCATGCTATCAGT
TCCAGTGGGAGAGAGAAGGCAAGAAAGTTCTATGAATCTGCTATTCGTCTCGAACCTGGATTTCTTGGAGCAGCATTGGCATTGGCTGATTTGCATGTTG
CTGAAGGACGGAATAAGGAGGCAGTTTTGTTACTTGAAAGATATCTAAGACAATGGGCCGATGATTCTCTACATATCAAGTTGGCTCAAGTATTTGCAGC
AACAAGTCTGCTTTCGGATGCACTCTCCCACTACCAATCTGCACTAAGGTATGCACACTTCCTCTTGAAGTGAAACTATGAAATAGCAGCCCTAAGTTGT
AGGAAGGCTTCATGCTGAATCCTGTATTTCCCCACCCTCTCAAATACCATCTGTTTACAGTCCTGGGCATATCTCTTCCAAGAGCTTATTGTCTTTCCCC
CTCACCAATGGGTCAATTGCTACCTCGAACAAGGCCAATTGGTGCCTGGAAGTTTGTAAGCGATTAAACTTGCTTGATTAAATGTAGGTAAATTCAGAGA
TTAGTATGTCCGGTTTTTTTTTTTNG
page-top