Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whva11f18
Contig Information
Length 649 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva11f18   
Homology (BLAST) Top Hit hypothetical protein OsI_37599 [Oryza sativa Indica Group]
Score 374
Evalue 1.9422e-71
Total Hit Count 41
Registered year 2003
Contig Sequence     [ Download ]
>whva11f18
ATACATCTAACATCGTGAATCACTGGAGGTGGAGGGATGTTTGGCAACACATCTTCACCTTTTCAAACATCATCATTTCAACAATCTGCCCCTGTTCAAC
CTACAAACTCGTTCTCATTCCAACCTCAGACTCAACCAGCTTTGACAGGTGGATTCTCTGGTGTTTCCAACCCGATGAATATGGCTCCATTCGGACAGCA
AACTACTAGCCAGTCCAATATGGTAATGCAGCCGACTCTTGTTTCAAATCCCTTTGGGACCCTTCCAGCAATGCCTCANATGTCCATTGGGAATGGTGGA
TCCTCACCTTCTATCCAATATGGGATATCAAGTTTGCCGGTTGCTGAGAAGCCCCTTCCGAGCAGAAATTATCAATGGTGGTTCCTAGGCATTTGTCACA
GAGGAGGATAAAGCTGCTGCCACGAAAATATAATGCAACATCCAATGGCAAGGNTCCATTCTTTGCTGATGATGAAGAATCCCCTGTAACNCCAAAAGCG
GATGCCTTTTTCNTCCCTAGAGAGAACCCNAGAAGTTTGATAATCCGTCCAACAGACCAGTGGCCTTCACGTAGTGTGGTTGGCCAACAATCAATTCCAA
GGGATTCNACTGATAATGACAAACATAAAGATGCTTTTGNTGGGAGGGA
page-top