Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whva11f12
Contig Information
Length 373 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva11f12   
Homology (BLAST) Top Hit mitochondrial uncoupling protein 3 [Zea mays]
Score 318
Evalue 4.0502e-28
Total Hit Count 498
Registered year 2003
Contig Sequence     [ Download ]
>whva11f12
GGGTCCGTCGTCTCGCTCGGTGGTGCCGGTGGTGGGCGGTTGCATCCACCCGTCAGCCAAGCCAAGCCAAGCATGGCGCCGGACCACGGCTCCAAGGTCG
ACATCTCCTTCGCCGGCCGCTTCACCGCCAGCGCCATCNCCGCCTGCTTCACCGAGATCACCACNATCCCCCTCGACACGGCCAAGGTCAGGCTGNAACT
GCAAAAGAAGGCCGTCGCCNGGGATCTCGCTGGGCCCAAGTACCGTGGCCTGNTCGGCACCGCCGCCNCCATCGCNAAGGANGAAGGNGCCGCCGCGCTC
TGGAAGGGCATCGTCCCTGGCCTCNACCGCCANNGNATCTACNGNNGTCTCCGCATTGGTCTCTATGAGCCCG
page-top