Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whva11e17
Contig Information
Length 846 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva11e17   
Homology (BLAST) Top Hit hypothetical protein OsJ_011449 [Oryza sativa (japonica cultivar-group)]
Score 583
Evalue 2.75557e-58
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>whva11e17
CTGGCTTTTTCTCTGTACTGGAGGACGCCTAACACAAACAGATAGCATGGACAAGCCTTCGATAGAAGAGTAAAATGATGGTCCAGGCAGCAAGTAGTTG
AACAACCCATAAGTGTATGGCGTCCTGGCTTTATTCTCTGTACTGGAGGAACAACATATGGCCAGCTTCCTACACATTCTAACATGTCCACTCCACCCAG
CGCTCTGATAAATGCAAATTTCTTGAGAAATATTTCGTCATGGATGCCAAGTAGGCGGACATCCACTGTTCAGACGTCTACTAATCAGGAACAAGAAGAC
CCGAGATTTCCAGGGAGAGGGCGGACGCTTGCTTCTACAGGAACTGAACCAACTGCAAGGGAGGCCAATGCAAATTTGCATGCTAGGTTGTTGGATAACT
CAACCCCAAGCGACCTTCTAACAAATTCACAGCATACAGCAGCAAACGCTGTCAGAGCTGATGCAACAGTAACAGCTGACCAGACTGATACATTCGATGA
AGAGCTTAAGAAGCTGGTTGCGATGGGCTTTGAAAGGACTCAGGCTGAAGTTGCTCTTGCCGCCGCGGACGGAGATCCAAACGTTGCCATTGAGATTCTC
ATGAGCCAGCAGGATTAGGGATTAGCCACACAATTCTATATCGAAGTGAGCGCAGTTATCGAGCATCATATCTCTTGCTTATCTGGAGGTTAGGTTCAGA
CTGTGGATGGGTAGTGGACTTTATAGAGATCATGGTGACAGAGTGGTTTTCGGAGAAGGTGCCATTGATTATGCAATTTGTATAGGTGCAGAAGCTACTG
TGTAGTGCCTGCTTGCATTTTGTCCAATCTTATGTAGTACACTAGT
page-top