Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whva11e10
Contig Information
Length 784 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva11e10   
Homology (BLAST) Top Hit hypothetical protein OsJ_000033 [Oryza sativa (japonica cultivar-group)]
Score 1130
Evalue 8.94109e-122
Total Hit Count 74
Registered year 2003
Contig Sequence     [ Download ]
>whva11e10
AATCCCCACCGCCCAACCCCAACCCCCACCCTCCCCGGCGCGTGCGATGCTTCGGCGCCGGCGGCGGCCACGGGTGGTGCAGTGATGGTGGGCTTCTTCC
GCAGCGGCAACCTTGCCTCCAGGGTGTTCGACCGCCAGTTCCTCTCTCCGCGCCCCGGCGCAACCGTTAATACTGTCAGACAATTCTATGAGAATTTGGT
TCCAAGTTACACTATATACGACATAGATTGCCCAGATTATTCGTTTCGCAAGTTCACTGATGATGGCAAGTATCTTGTGGCCTTTAGTCGAAACCACCAA
GATTTGATTGTGTACCGTCCCATCTGGTTAACGTTTTCATGCCATGAAGAATGTGATTCTCATGATCTTCCGGCCAATGCAGAGAGATTTGACAGTTTCT
TTAAGCAGCTCTACTCAATCTCACTTGCATCCAGCAATGAGTACATTTGTAAGGACTTTTTCCTTTACATGGAGTGCCATCAATATGGCTTATTTGCAAC
GTCAACTGCACAAAGTAATGACTCAAGTGCCACTGACGGTGCAATTCACGGGGTACCATCAATTGAGAAAATAACTTTCTATCTTGTGAGGCTAGAAGAT
GGTGCAATACTAGACGAGAAAGCTTTCTGCAATGATTTTATCAATTTGGCTCATAGTATTGGTGCTTACTTGTATGAGGATCTGGTTTGCATTGTCTCTC
TACGATATCAAACAATACATGTCCTACAAATCCGAGATTCAGGCAGCCTTGTTGAGGTACGGAGAATTGGTGCATTTTGCCGGG
page-top