Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whva11c13
Contig Information
Length 754 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva11c13   
Homology (BLAST) Top Hit vacuolar proton-inorganic pyrophosphatase [Triticum aestivum]
Score 1045
Evalue 5.92463e-112
Total Hit Count 479
Registered year 2003
Contig Sequence     [ Download ]
>whva11c13
ACCGCCGCCGTCCCGTCCGTTCGGTCCGTTAGGGTTTCGTCGGCCATGGCGATCCTCGGGGAGCTCGGCACCGAGATCCTCATCCCCGTCTGCGGGGTCG
TCGGCATCGTCTTCGCCATCGCGCAGTGGTTCATCGTCTCCAAGGTCAAGGTCACCCCCGGCGCCGCCGCCGCCGGCGGCTCCAAGAACGGCTACGGCGA
CTACCTCATCGAGGAGGAGGAGGGCCTCAACGACCACAACGTCGTCGTCAAGTGCGCCGAGATCCAGACCGCCATCTCAGAAGGAGCAACATCATTCCTT
TTCACCATGTACCAGTATGTTGGTATGTTCATGGTCGTCTTTGCTGCGGTTATCTTCGTCTTCCTTGGGTCAATTGAGGGATTCAGCACAAAGGGCCAGC
CCTGCACCTACAGCACGGGCACCTGCAAGCCAGCTCTCTACACCGCCCTCTTCAGCACTGCATCTTTCTTGCTTGGAGCCATCACATCTTTGGTGTCTGG
TTTCCTTGGGATGAAGATCGCCACATACGCCAATGCTAGGACGACCCTGGAGGCAAGGAAGGGTGTTGGGAAGGCATTTATCACTGCTTTCCGCTCTGGT
GCAGTCATGGGCTTCTTGTTGTCATCAAGTGGGCTTGTGGTTCTTTACATCACCATCAACGTGTTCAAGATGTACTACGGTGATGACTGGGAAGGTCTTT
TTGAGTCCATCACTGGTTATGGTCTTGGTGGGTCTTCCATGGCTCTATTCGGAA
page-top