Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whva11a07
Contig Information
Length 693 bp
Tissue Shoot with ABA treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whva11a07   
Homology (BLAST) Top Hit hypothetical protein LOC100193581 [Zea mays] >gi|194693610|gb|ACF80889.1| unknown [Zea mays] >gi|195641460|gb|ACG40198.1| hypothetical protein [Zea mays]
Score 577
Evalue 9.30869e-58
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>whva11a07
CTCTGGAGTCGTCGTCTCTGCTCCGGTCTCCGGAGAAAAGCAAAGCCAGCGCCGAGCAGCAAGCCCCACACGCCAATTCGGAATCCTTCTCCTCCCCTCC
AGCCCCGCGATCCCGCCCCTCGCCGCCTGCCCGATCGGCCTGCTTCCTGCCGGGGTCTGGTGGGTGTACGGAAGAGGGCATTTCTTAGTTGAGGATGTAC
AGTTAATCTGCAGCAGCTCGAATTGTAGCATTTGGTTCTTCTGACATGGCTGAAGGGGCAAGGTTTCATGGCATGGTTGGCGGTGGCGGCAAGGGGATGC
AAGAGAACGAGTTCAATGGCTTCTTCAGCATGCCCTACTATCAGAAAATTGGGGAGGGCTCCCACATGTCTGTCGACAGCACTGACAACTACAACCTCGC
CGGTGGCTCCGTTACCATGTCAGTGGACAACAGCAGCGTGGGCTCGAACGAGTCCCGTACCGTCATACTAAAGCACCCGGGCCTCCGTGATGCCCCAACC
GCAAGCTATTCGGTTGGCAACAGTGTCTTTCGTCCCAACCGTGTGGCTGCGCACACCCTAAATGAAGATGCATTGGCCAGGGTTCTGATGGACCCGAATC
ATCCAACAGAGATACTTAGCAAGTACCAGCAGTGGGCCATTGATCTGGGGAGGTTGGATATGGGGGTTCCCTTTGCACAGGGAAGCCTTTGGG
page-top