Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1950
Contig Information
Length 579 bp
Tissue Seed DPA20
Clones 4 Clones [Download: CSV  ,  FASTA ]
whdp10f12    whdp8l24    rwhdp10f12    rwhdp8l24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glyoxalase family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|125585786|gb|EAZ26450.1| hypothetical protein OsJ_009933 [Oryza sativa (japonica cultivar-group)]
Score 506
Evalue 1.04897e-49
Total Hit Count 114
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1950
TTAAGGCAAACACCGAGCCATCTCAAAGTGGTTAGCAGTAGCACCCGTACCCACGGAAGGGACGAGCCATGGCGTCTGGGGCGGTGAGACCTAAGCTCGC
GTACATCGTGTGTTACGTCAAAGACGTGCCCAAGTCGGCCGCCTTCTACGCCGACGCCTTCGGCTACAGCGTCCGCCGCGTCGACGACTCTCACAAGTGG
GCGGAGCTGGACACCGGCTCGACGACCATCGCGTTCACGCCGCTGCACCAGAGGGAGACGGACGCACTCACGGGCGAGGTGCAGCTGCCCAAGTCGCCCC
GCGAGCGAGGGCCCGTGGAGATCTGCTTCGACTACGACGACGTCGACGCCGCGTACCGGCGGGCCGTGGAGAACGGGGCGGTGCCGGTGAGCGCGCCGGA
GCAGAAAAACTGGGGGCAGAAGGTCGGCTACGTCAGGGACTGTGACGGGATCACCGTGCGCCTTGGGAGCCACGTCCGCGAGTAGTGGCATCCCTTGCTC
GTGTCTGTCTACTGTAATGACTAGTAATGCTACTGTCNATANCAAATAATAAATCNCCGTGTCCANTGACAAAAAAAAA
page-top