Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1927
Contig Information
Length 632 bp
Tissue Seed DPA20
Clones 4 Clones [Download: CSV  ,  FASTA ]
whdp10e13    whdp10e14    rwhdp10e13    rwhdp10e14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11539 [Oryza sativa Indica Group]
Score 407
Evalue 3.90861e-38
Total Hit Count 229
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1927
CCAGCTTCTCTTCGTCCTCCCGCAGCGCCTCCTCGAATCCAAGAGATCAAGGTGCGTCCCTCTCTGCCACCTCCTTTCGTCGCTGTTGCTGTGCCACTCC
CCCACCAGCCGCCACCATGCAGAACGAGGTGGGTGACATGGTGGACCTCTACATCCCCAGGAAGTGCTCGGCCACCAACAGGATCATCACGGCCAAGGAC
CACGCCTCTGTCCAGATCAACATTGGTCACGTTGATGAGAATGGCCTCTATGATGGCCGCTTCACCACCTTTGCTCTCTCTGGGTTTGTCCGTGCTCAGG
GTGATGCTGATGGCTCCCTGGACAGGCTGTGGCAGAAGAGGAAGGCTGAGATCAAGCAGCTCTAGATGTTGCTACTAGTTTTACCTGGAACTTGTTTCCT
TCCCATGTCTACCTAGCTCTTGGATGTCTGTGGTTAGTTTCAGTTGCTACTATGGAAGCTAAGACTTGATGTCAGCTAGGCCTGGTTTCTTGTGAACATG
TTTTGAGTTTAATCTGTGTTGAATGCTTGATATGTGTACCTTATCTCGTTGCTTAATGTCATACTGATGATTTGGCCCTTACTTTACTANCAAATTATGG
CCATACTGATGATTTGGCCCTTAAAAAAAAAA
page-top