Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1894
Contig Information
Length 663 bp
Tissue Seed DPA20
Clones 4 Clones [Download: CSV  ,  FASTA ]
whdp10a01    whdp3l22    whdp3n24    whdp13n23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08032 [Oryza sativa Indica Group]
Score 266
Evalue 1.03371e-31
Total Hit Count 169
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1894
AATTCCTCCCACCCTCGCCGATCTCGCCGCCGTCACCACCGTCAGCTAGATAAGAGAAAAAAAGAGAGAGAAGAACTCGTCGGGAGGGCTCGAGATCTGT
GTTGGGAGAGGGGAATTCTTGAGGTCGGAATCGGAACAAGCGGGCGCGCTCGGGATCGGGGTTACCATACAATTTTTCCCAGGAACCTTTAGTGAATGTG
CTAATGGAGTCAAAGGGTGGCAAAAAGTCTAGCAGTAGTAGTTCCCTGATGTACGAAGCTCCCCTCGGCTACAGCATTGAAGACGTTCGACCTGCTGGAG
GCGCCAAGAAGTTCTCTGCTGCATACTCGAACTGCGCGAAGAAGCCATCCTGATATCGTTTTTGGCATCCCCTTCCCGTAGTTTAGGATTTTTATGCAAT
TTTATTCTGACTCTTTTCTCCCACCAATCTCTCTGGCTTGCTGCTTCATCTGTTCCTCTCTGCTCTGCTTTCTGACTCAAAACTGCAACAATGGCTGCCC
CGACCTCTGCGATCGGATTTGAGGGCTACGAGAAGCGCCTTGAGATCACCTTCTCTGAGGCATCAATCTTTGCTGACCCTCATGGTCGTGGCCTGCGCGC
CCTCTCCAGGGCCCAGATTGACTCTGTTCTTGATCTTGCACGGTGCACCATTGTGTCCGAGCT
page-top