Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1893
Contig Information
Length 964 bp
Tissue Seed DPA20
Clones 4 Clones [Download: CSV  ,  FASTA ]
whdp10c01    whdp7a23    rwhdp10c01    rwhdp7a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0193900 [Oryza sativa (japonica cultivar-group)] >gi|40253673|dbj|BAD05616.1| putative N7 protein [Oryza sativa Japonica Group] >gi|113623151|dbj|BAF23096.1| Os08g0193900 [Oryza sativa (japonica cultivar-group)] >gi|125602467|gb|EAZ41792.1| hypothetical protein OsJ_025275 [Oryza sativa (japonica cultivar-group)] >gi|215741545|dbj|BAG98040.1| unnamed protein product [Oryza sativa Japonica Group]
Score 653
Evalue 2.60281e-66
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1893
CTCCCTTTCCTACCTTCTCGAGGAGCCTCGCCGACTGCCGCCACCACCACCGCCCCAGGACGGGATGGATACAGAGGCGGAGTGGAGGGATTGGGCGGAG
CTGCCACGGGATGTGTTGCTGGCAGTGCTCAGCAGGCTGGACCACATCGAGATTCTCATGGGGCCCGACATGGTGTGCAGCCCATGGCGCAGGGCTGCTA
CGGACGAGCCCGAGCTGTGGCGCCGCATCGATATGCGCTTTCACTATGCCGATGGCTTCTACCTCAACTCCAGGAAATTGCTTCAGATGGTGAGAGCTGC
CATGAGGCGTGGTGCGGGTCGGTGCGAGGCCTTCTGGGGTGGGAGCTACGTCACAGAAAGGATTCTCTCCCTCGTCGGCAACGCGGCGCCATCATTGAAG
AGCCTTCGACTCATTGAGTGCCATGACATTGTGGACTTGGCCTTCAAGCTAGTGATCACAAAGTTCCGCATGCTTGAGGAGTTAGAGCTCTCGAATTGTA
TGCACCGCTTCCCAGAAACACTCGAAGTCGTAGGGGATGCTTGTCCTCTACTGAAGCGCTTTCGATTGAGCCAAAGGTCCTTCTACAGTGAATGCGTAGA
TGACAGCGCAGCCATGGCGATCGCTAAGATGCCGGAGTTGCGGTCATTGCAGCTCACTGCTAATTCGCTCACCAATAGTGGTTTGGAACTCATCCTTAAT
GGTTGCCCGCTCCTTGAGTCTCTCGATATCCGGTCTTGTTACCATGTTTGCATGGATGATGAAATGCAAGCAAAGTGTGCTAGGATCAAGACTCTGAGGC
ATCCTGAAGACTCCATGGATGATTATGACATGTCGTTTAATTATACAATTCCGAGACCATGCTGGTCTACTGAACCAATCGAATACTCTATGGGTTGTCA
AAGTCCTTACTAGTGTTCATGGTATGTACCGGTAGAACATCCACCCTACATTTCTTGAGATTCG
page-top