Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig76
Contig Information
Length 510 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl49p03    rwhfl49p03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HvB12D [Hordeum vulgare subsp. vulgare] >gi|3445292|emb|CAA70936.1| B12Dg1 [Hordeum vulgare subsp. vulgare]
Score 447
Evalue 5.08723e-43
Total Hit Count 64
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig76
ctCAACCGCCGTCGCGTCTCCACTTTCCTCTCCATCTCACTCACTCTCCCCCTCCGCCGCCGGCGCAGCGTCCTCCCCGCGACTCCGATGGCCAGCAAGT
GGGTCAGGCCCGAGGTGTACCCGCTGTTCGCGGCGACGGGCGTGGCCATCGGCATCTGCGCCTTTAGCCTCCTTAGCAACATCACCGGCAACCCAGAAGT
CAGGGTCAACAAGATGGGGAGGGCAGCGGGAGTGCTTGAGAACCATGAGGAGGGCAGGCGCTACGCCGAGCACGGCCTCAGAGCTTATGTGCAGGACAAG
ACCCCCGAGATCATGCCAGGAATCAACAAGTTCTTCACCAGCCCAAAATGAAGCACTTTAGTCTGTCTGTGACTCGCTATTAGtaactgttgtggtcaag
tgcaaacctatttcaagcattcagtaatgttgttgcgtccataattcagaggacatcgtcaattacctcttattgaaagaaccatgtgatgtttgatggc
ttgctatata
page-top