Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n5h20
Contig Information
Length 804 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n5h20   
Homology (BLAST) Top Hit hypothetical protein OsI_27446 [Oryza sativa Indica Group]
Score 560
Evalue 1.15115e-55
Total Hit Count 95
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n5h20
TTTTGAACAGCCTTGTTTAATGTTCTACATACCACTTTAGTGGACTGGAATTACAGGTTACCAAAACAAAAGAACAGCAGGGCTCAGCAACAACTTTCTC
CTACCACTATTTTCAAATTCTTAGCGTAATAAATGTTTTATACAAATCGCGCAGCAGCTGAACACTGCTTCGCCACATGGTCTTGCCATGCCATCTTTCC
CGGTACTACATTAATGCAGGCAGCACTTCGTCGCCTGCCAAATGCCTCCATTCTGTTCCAGCAAATACAGAGAAGGCCAGCACTGCTGCGGGGGAAATGT
CAACTGGCGGCGGAGGATTCCTGAGTTACTTCCGTCGTGGCCTCTGCGGCGGAGCTGCTGGTCTCCGCGGCCTGGTTCTGGCTGCTCTGTGCCTCAGGTG
CGGGCTGCTGCTGTTGATCTTCGGCGAGACCCAGAACCACCAAGATAGATCTCGGGAGAGTTGATCGCACGTTTGGCTGGCTGGCATGCTCGACCAAGGG
CGCCTTCAGTAGAGGGTTCTTATTCAGGGCATTTTCGAGTTGTGGAGCTGGTAACTGCAGTAACACACCATAGGACTGAGGTTTTATCAGGATAGCACAC
TTCAGGAATCCTACCCATAACTTCGGATATTTCCATATCTGCTTGTTAACAAGGCGTGACATGATCTCCATCACAAAATCCACCAAGGCAGGAAATGCAC
TTATCGCTTGCATAACANTTCNCATGAACANCAAAGGTANGGGAATCTGTTCAACCANTTGGTTTANTGCTTTTGCCAAAACTTGCTGANTGAATGTTGT
CCTT
page-top