Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n1c24
Contig Information
Length 773 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n1c24   
Homology (BLAST) Top Hit Os02g0609400 [Oryza sativa (japonica cultivar-group)] >gi|47496841|dbj|BAD19601.1| putative iron-stress related protein [Oryza sativa Japonica Group] >gi|47497956|dbj|BAD20161.1| putative iron-stress related protein [Oryza sativa Japonica Group] >gi|113536925|dbj|BAF09308.1| Os02g0609400 [Oryza sativa (japonica cultivar-group)] >gi|215692432|dbj|BAG87852.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767709|dbj|BAG99937.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218191143|gb|EEC73570.1| hypothetical protein OsI_08016 [Oryza sativa Indica Group]
Score 661
Evalue 2.09589e-67
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n1c24
AATCTTTTCTTTCACCAAATACAACTTTTACCAGGACATTGTGAAGGCAGAGTAATCGAGTACCTACCCGGTGACTCAGGTTCACGACACAGCAATGCCC
TTCCATCTGTAAGGCTACAAGAGATTGACTGCTGCTCCCATTTTAGAGAAACCAAGCAGCCGCAGGTTAGACTAAAATTTGGACTTCTCATCATACATAT
AGTTTTCAAACGAAACTGAACACAAATTGAGCTGGCAAAATAGCTTGCTTCTGATAAATCTGTGACGCTCCACCGATGCAGCTTGACTTTAATTAGTTCC
AGCTGCTGAGCGCCGCTGCCAGGCCCGTTTGAGCATCTACTGCACGACGCAGATCTTCGAGGAAGTTCATCTGATGAGGAAGCTTCATGTGACCTTGACC
CCATGACGATCCGCCAGATCCAGCGTACATCACTGGTTTATCAGGGGAATCATTTGGGTCATTATACATGTTCATTGCAGCAGCCCAACGTTCACTGAGA
AGCTGTGAAGCCTCACTGGCAGAACATCCTTCCAATGGTACTAATCTTGCATGACTGTAATCATTTTGAGCATTGCTGACAAAAGCATCATGATGGATAA
TTGGAGGAAGGTTCTTTAGTGAAGGAACATGGCTCTTCTCTCCATCATTGTTGTATGAATAGTTGGCTTTCTCAGCCCTATCTCCAGCCTTGCGGCGATT
GTTTGCACGATTCCTGTGCACGGGAGGCGTGTATCTCTTGATGCTGTCCGGGTTGCTATCCGCCATGGCANCA
page-top