Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1870
Contig Information
Length 577 bp
Tissue Seed DPA20
Clones 4 Clones [Download: CSV  ,  FASTA ]
whdp9n09    whdp14i13    rwhdp9n09    rwhdp14i13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0502000 [Oryza sativa (japonica cultivar-group)] >gi|113631817|dbj|BAF25498.1| Os09g0502000 [Oryza sativa (japonica cultivar-group)] >gi|125564262|gb|EAZ09642.1| hypothetical protein OsI_31926 [Oryza sativa Indica Group] >gi|125606230|gb|EAZ45266.1| hypothetical protein OsJ_028749 [Oryza sativa (japonica cultivar-group)] >gi|215767820|dbj|BAH00049.1| unnamed protein product [Oryza sativa Japonica Group]
Score 649
Evalue 2.74767e-66
Total Hit Count 438
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1870
CCGCTTCTGACGAGGAAGATCGTGAAGAAGAGGGTCAAGCACTTCAAGAGGGCCCATAGCGACCGCTACATTGGCCTCAAGCAAAGCTGGCGCAGGCCAA
AGGGTATCGATTCCCGTGTCAGGAGAAAGTTCAAGGGATGCACCTTGATGCCCAACATTGGCTACGGTTCTGACAAGAAGACGAGGCATTACCTTCCCAA
CAAGTTCAAGAAGTTTGTTGTCCACAATGTCTCTGAGCTGGAGCTGCTTATGATGCACAACAGGACCTACTGTGCGGAGATCGCCCACAACGTCTCCACC
AAGAAGCGCAAGGACATTGTTGAGCGTGCTGCTCAGCTCGACATCGTGGTTACGAACAAGCTTGCCAGGCTCCGCAGCCAGGAGGACGATTAGACTGTCT
GTCAGAAGTATGTTTTGGTCTGGTTCGTATGTAGGAAAGTATTCCGCTGTTCGTTTTGTGACTGTCAGGGGTATCTGTTATTCCAACCTTTTTGCTACCA
GTGCCGACTGTAATGTGTCAAAGATCTACTATTGCCTTTATAATCTAGATCCGATTGCCAATTGCTGAAAAAAAAAA
page-top