Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n1e03
Contig Information
Length 866 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n1e03   
Homology (BLAST) Top Hit hypothetical protein OsI_10925 [Oryza sativa Indica Group]
Score 761
Evalue 6.48941e-79
Total Hit Count 166
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n1e03
GTTAGCTCATTGTATAATACGTGAAAAGCGCAACACTGCATTGTCAATTAAGCTAACCGACTGAACAACAAAGTGTTACATGGAAACAAATTGACTATGA
CACAAAGCCTTGTCAAAACATTCCTTGGTAACACTAGGAGCTCAGCTTTCATCTATTCAACCAGCTTGAAGCTCTGCAATAACAGACCTTACTTCCTACT
AGAAGCAAAGAACTCACCCTGACACTAACTTATCTCTCTTCCTCAAAGAAGGAACAAAACTTCATTATTCAGCAGAACACAAGTCACCTGCCGTTCACAC
CCACATGCATAGCCACTTTGAGACTCAACGCCTCAATTGTGCATTAAACATCCCGTCTTCAAGATATGTGCTGAATGAAATGCACTCAGAATCTCTCGCC
AAATCTGAAGAAGACGGTTCCAGCCCCAGTATTGTGATCTACGATGTACTCTCCTCTTACCAAGCCAAGCTTGACGCCAACACCATAAGAAGATCCATGG
CCAACGCGTCGGAAGAACTCAGTAGGGTTCCCTTTCACATCCTTGGAACTCCCAAGGTCGGTGCCATGCTCAGCAAATCCATAAACATATGTGTTCTTCA
CGGGTATGCGCACCTCACCAGCAACCTCCAGAACATTCCTAGATGCACCCAGTTCACCCATACCATAGCCCCTAACTGAGTAAGGTCCTCCAAGTGTAAA
TGCATCATAGCTCGGCAGATCTCCTACACAACCTGCATAATGACCATGAAGAACCAACACAGCTGGCAGCGGCTTGCCAACACCTTTCTCTTGATTATTT
AAATTAATGAACTTTGTCAATGTAAGCTGATGACGGTTNAAAGAGTGGGCTTTTGCTTCCAATGNC
page-top