Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n1g01
Contig Information
Length 821 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n1g01   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 365
Evalue 4.91697e-33
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n1g01
GAAGTTAACGTGGTACAAAAGAGATAGTTATACTGTACTAGTTAAGATCCAAAACAGATAGACGTTGTACTAGTTAAACACGACGTAAAAGATCACTGAT
CTTCTTGAGTTCCTCGAGGGCTGCAAGCGCCTTGGCTTGCTCTGTGCTTCCGGGACCATTTTGCACTGATGCCATGTGTGAATTTGGTCGAAAGTGTAGT
TCAATAACCTGAATATTTTCAACCATTGATTCGCCAAAAGACCTTAATGTTCCGACCAACTCCTTATCAGCCACCTTCAAACTTGGGCCTACGTCAGAAC
ATATGCTATGCTCCTGATTTGGTTGACAATCCACCGATTCAAATGTTTGATCTGTAATTGCTGATCCATCAGTCTTACCATCACTCTGACAGGGTTCGTC
AGTCTTATCATTATGCACAGACAGTGGGTCTGGCTCATTAACCACCTTGGCGCCATGGGAAACGCATGGTTCTTCCTCATGACGGGTATCATGGTCATGA
TCAGTACGACGCCGAAAGGATGGAGGCCTATTCCTTGATAAATACTCACGAGCTCCATCAATACGATCTCTAATTTTGGCAGAAGTTGTACGGTAACCAT
CATGCGGGCCTGCCTCACATAGACTGTTTGAGGTACTTCTAACGATCTCTGCAGTACCTTGACCAACACAATCCTTTTGGTGTACTATAGGCATGGTTGG
TAAACTGTTTATCAATTTGACAGGAACTATGTCAGTGGTGTTCAGTTCATCAATAATAGGCTCAGGCTGGCTAGTTGAAAGTTGAATTGCTGTTATCAAC
ATTGGCACCCTTTGTTCTANA
page-top