Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1862
Contig Information
Length 1620 bp
Tissue Seed DPA20
Clones 4 Clones [Download: CSV  ,  FASTA ]
whdp10c13    whdp14a03    rwhdp10c13    rwhdp14a03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07101 [Oryza sativa Indica Group]
Score 809
Evalue 2.79874e-150
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1862
ATGATCCTGAGGGCTGTGACTTGATTCACCTTCGAGCCATGTCTGAATTGAGGTACCTTCAGATAGAGAGACTTGATAGGGCTACTTCTGGAGCTTCTGC
ACTTGCAAACAAGCCATTCCTGAAGGTTCTACACCTGTCTGAGCAAGCAGCATTAATTGAGGAAGAAGAGAATGGGGAAGAACAGGAGAACCAAGAGGGC
GCAGAGAAAGAAGAGAAGGACGAACATGAAGTAAAAAATGCTCAGTGGATTAGAGACGATTCAGCTAAAGTGAGTGAAAAGATATGGAATGAGCTCACGC
CACCCAATAGCGTTGAGAAGCTGGTAATCAAGAACTACCAAGGTCGAAAGTTTCCAAACTGGATGGCGGGTCCCAAGCTAAGCACCTCCTTCCCTGCCCT
TGCCTTCCTTGATCTTGACAACTGCATGTCATGCACCACTCTGCCTGCTCTTGGCCGCCTGAAACAGCTCAAGTCCCTGGAAATCTCAAATGCAGACTCC
ATTGTCGCCATCGGTTCTGAGTTCCTCGGCACCACTGTGATGTCACGAGCCATCTCATTCCCCAAGCTTGAGGTTTTGAAGCTAAGAAACATGAAGAATC
TGGAAGACTGGTCCTTAAGTGTGGAAGAGAGCCAGACATTGCTGCCTTGTCTTAAGTCACTGCACATACAGTTCTGCCCTAAACTCAAAGCTCTGCCAGA
AGGTCTAAAGGACGCTGCTCTGTGTGACCTTCATGTCGAGGGTGCACATTGCCTTACAGAGATAAAGGGACCTGCCAAAACTATCTGATGAACTCTATCT
GAAAGATAACAGGGCGCTTCTGAGGATCTCCAACCTACCCGCACTCAAGTCACTCACCATCGACGACTGCGCGAAGCTGAAGCACGTGTCGGGCCTCGAC
ATGCTGCAGCATCTCAGGCTTGTGTTCCCCCCATCCACGGAGACATACTATTTCGAGGAGTTGGTCATCTTCTGGAACATCGCATTCCCACGGTGGCTGG
AGCTGCTGATCCGTTTGCAGGCCAATGGCCTGCGTCGATTCGAGCTGCAGTGTGCACTCCCTTTACTCAGGAGCTGCCTGGAGGGTGGGAAGAACTGGCA
CGTTGTGCAGCAGATCCCTGAGGTGCGCATCACAAGCACCGATGGCAAGAAGTACATAAGGTACAACAAGGCCCGTCGCATCTACGAGACAAATGCTCAG
TGTGAAGAGAAGTCTACCTAAAAATCTTGGAGTACTTGGCAGCTGTTTGGTAGACATGTTTGGTCCGACCGTCCCTACTGCTCCAGGAGATGTCGTGGTT
TACATCAGGGAGTCGTCGTGTTGTTACTAGAAATGGTTTGATGAGGCCTGAGGAATGAGTACCGTATTTTTGGTGAATCAGACAGCAGATGGTCTTTCCC
CCCCTTCCTCAGTACTGAACTTGGCTTAACTCCTTCACCAATACTCGATGTGTGATTCTTTTCCGTTTCCTGGTTCTGGCGATTTGTAAATTGTAAACAT
TGAGCTTGATGGATTTTGATGAGTGTAAAGTATTGCCACTTGTGTACATGGATTTGTTTTTTTTCTTTTCGTGTCGGAATGTTTTCTATCAAACCATGTA
TATTTATGTAATTGGCAAAC
page-top