Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1858
Contig Information
Length 266 bp
Tissue Seed DPA20
Clones 4 Clones [Download: CSV  ,  FASTA ]
whdp10a05    whdp10a06    rwhdp10a05    rwhdp10a06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GJ16328 [Drosophila virilis] >gi|194141048|gb|EDW57472.1| GJ16328 [Drosophila virilis]
Score 77
Evalue 3.54937
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1858
CTCCTAGTAGTCTTCCTCTTACTTATTATGATCATCCATCATTCTGCGTGTGCCCATATTATATACTCCGTATATAATGTCACATATGTGCGTGCGTGCA
TGGCCGGTGCGTGCCATTCAGCGAATAAATGTATAAATAAAATGGAAGTGTAATTTCTACGGTTATGTGGAGTGCAACTCTGTTTTATTTTCTTATCTTT
TTATGCCATGAATATTGCTACATCTATGGAAAATTTCTTACGCACAGAATTCCCTGAAAAAAAAAA
page-top