Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n2k08
Contig Information
Length 770 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n2k08   
Homology (BLAST) Top Hit hypothetical protein OsI_14693 [Oryza sativa Indica Group]
Score 592
Evalue 2.08395e-59
Total Hit Count 327
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n2k08
TCATTTGCTGGTTCAATCCTTGTGTCAACCAAAATATTCCATCAGCCACATACAACCAACCAAACGGACACACATGGCAGTCACCACATGATTGTTGTAC
CGATTTGTAAAACTATCTTACCCCGACGACGGAAACTAGATATATATGGTATGTGTTTACCGGCAAACTATATATGGTCCATACAAAGTACAAACATTCT
ATAGCATATTTCAGGTTAACTTGTGTAGTAGCGCCCACTCGTCGGATCAAACGTCTCTCGTTCGACCGCGTCAATGGCTCGTCAATTTTTTTGCGACATG
GTGAAGAACCGTCCGGATTAGTCCCACGGCTCGTGGAGGTTCAGGCTCTCCATGTTCGCCTCGATGTCTCCCATTGATTTCAAGTCATCTGTTCCAAAGT
AAGATAGTCTGGCTTCATGTAACGAGTCTGCATTTATTCCCTTCCGTGCACAGCGAGTGTTTTCCTTTTCTTCATAAAAGTCAAAGTCGTCCAGAATTGA
TGTTCCATGGCGATAAGCCTTGAAAATTTTCAACACTTCCAGACCCTGGGGCAGGCCAATCTCTTGAGTGTCCCTGCTGAATGTAACAGGTCTGTTGTCA
TTATTTTCTAGGGTGATATGTTTGAAGAGCCTATTCGGAATGTCCTTTATAATGTGCCAAACAACAGGGAAAAAGCCATTCCATTTATTTTGTTGCCAGA
AGTCCATGGTCTTCTTGAAATCGACAGGACCTAACATCTCANCCAATCCCACAAACTGCCCGCTGGTATT
page-top