Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n2p04
Contig Information
Length 380 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n2p04   
Homology (BLAST) Top Hit Os05g0182600 [Oryza sativa (japonica cultivar-group)] >gi|75253362|sp|Q65WY8|SSP1B_ORYSJ RecName: Full=FACT complex subunit SSRP1-B; AltName: Full=Facilitates chromatin transcription complex subunit SSRP1-B; AltName: Full=Recombination signal sequence recognition protein 1-B >gi|52353744|gb|AAU44310.1| putative HMG-box with DNAbinding protein [Oryza sativa (japonica cultivar-group)] >gi|57900696|gb|AAW57821.1| putative HMG-box with DNAbinding protein [Oryza sativa (japonica cultivar-group)] >gi|113578371|dbj|BAF16734.1| Os05g0182600 [Oryza sativa (japonica cultivar-group)] >gi|125551089|gb|EAY96798.1| hypothetical protein OsI_18726 [Oryza sativa Indica Group] >gi|125593050|gb|EAZ33109.1| hypothetical protein OsJ_016592 [Oryza sativa (japonica cultivar-group)]
Score 95
Evalue 0.0289984
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n2p04
CGGTGGTGCTGANTTCAAGGTTGATGTTCTTCAAATTAGCTCGNTCANCCTTTGAGAAATACNTGAATGGNGCTATTGCTCTTTTAGGGGCATTGGGATC
TTTCTTCTGCTTCTTCTTCGGCTTTCTCTTCTCTGAACCTTCCACGTCCACATTCTTTGGTTTCCTCTTCNCAGGTGGCTTTGAGCTACTAGCTTCCTTT
TTGGAAGATTTCTCCTTTTCTCCATCNCTTATGCTGGCATCAGAACCCTCTTCAGAATCATCACTAGGGGATCCGCTGTCGTCCCTTGTCCGCCACAAAA
TCTTCGTCCTCTTCATCACTTTCTTCATCANCGGCCTGATTTTTAATTCGCTCCANATGTGGATCAACAGGGTCNATCAT
page-top