Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n2l05
Contig Information
Length 707 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n2l05   
Homology (BLAST) Top Hit RecName: Full=Phosphomannomutase; AltName: Full=TaPMM >gi|90762172|gb|ABD97875.1| phosphomannomutase [Triticum aestivum]
Score 953
Evalue 2.42214e-101
Total Hit Count 222
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n2l05
CTACTCCCAACGGGGAGGAACACAAAAAATGTACTGAGTTCAAAGGGAGATCTATAGAGGAATTATTTCGAGACGGCAAGNGTTCNAGGGGTGCAGGTGA
ACAAATGAATGTAAACGGCACGGTAGTCTGGCGATCACTCCGACAGGAAGATGGATTTGCACTGCTGCACAGTGTCATTGGGGCTGGTAACTGTATGACC
AACTGTTCTGTCANATTCAAATATCTCATGATCATTGCCACCCTTGTAGGTTTTGTCCCCAAAGAAATGGATTTCNTTGAATTCTTCCAGATATCTCAAG
CAGTAGGTTTTGTCCCAGCCTTGTGGGAATACATCAAAACTGATCTGCCCTCCAATAGAAAAAGTCAGGTTCAGGTGTGCAAACTTTTCACGAAGCACTG
ACACCATTTTAGGCCGAACGTTATGTACCTTATCATACTTCTCAAAATCATCACGTTCTTCTTGACTACAGTTCCTCCCTATAGGCGACACATTGATCAT
TCCACTCCTGAACTCTATGAATGTACCCCTTTTAATTGGGATATCCAAATCCGCGATGTAATGAANAGTGAAGTTAATGAATTCCTTAAGCTGGTCATCT
CCAAGATACGTTTTCAAGCTTTGCGTCCCNATGAGCTTGCCGTCCTTGTGCGCGACCANGCCGTTCTCNGANAANACGTANTCNTANTCNGNGATGACTG
ATTTNCC
page-top