Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20f24
Contig Information
Length 163 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20f24   
Homology (BLAST) Top Hit putative asparate aminotransferase [Hordeum vulgare]
Score 88
Evalue 0.187728
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20f24
TACATGCATCGCACCGGAATGNGGATCAGATCAAGCAGGACTTTATTCAAACGATCAATCAACAGCTACACGAAACTGCCGCCGCCCAATCATTTCATTT
CTTCCTCAGCTTGGCCTTCATCCGGTCCACCGCGGCCCTCANCGTGCCGTCNTCCTTGCANAA
page-top