Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20g09
Contig Information
Length 157 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20g09   
Homology (BLAST) Top Hit MLo protein [Triticum aestivum] (no hit)
Score 704
Evalue 1.67752e-72
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20g09
CACNGCCANAAAGGGTGGTCNTAACTGCAAGGATGCAAACCACGAAGAAAAATAAATTGTTCANAACATGGACATGAGGAGGCAGGCAACAAAAAATGGA
AGAACATTGNAGGAAACGGCTCCAATTATTAACACAGAGGGTGGATGGCTTGGCTTC
page-top