Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n2f09
Contig Information
Length 678 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n2f09   
Homology (BLAST) Top Hit MLo protein [Triticum aestivum]
Score 704
Evalue 1.67752e-72
Total Hit Count 162
Registered year 2003
Contig Sequence     [ Download ]
>whv3n2f09
GTCTGCCACAGCAGCAACAAGCTAGACATACCTGCGTGCGTACGTACGTTTTCGTTTTCCTTTCTTGCTCCGGCCGGCCGGCCGGCCACGTAGAATAGAT
ACCTGCCCAGGTACGTACCTCGTTGGCTCAGACGATCGGCGGTTGGACTTGGGTGCGCGCCCTGCCCTGCTCCGGCCAAGGAAAGAGGTTGCGCTAAAGA
CGGGCGGATGGCAAAGGACGACGGGTACCCCCCGGCGCGGACGCTGCCGGAGACGCCGTCCTGGGCGGTGGCGCTGGTCTTCGCCGTCATGATCATCGTC
TCCGTCCTCCTGGAGCACGCGCTCCACAAGCTCGGCCATTGGTTCCACAAGCGGCACAAGAACGCGCTGGCGGAGGCGCTGGAGAAGATGAAGGCGGAGC
TGATGCTGGTGGGATTCATCTCGCTGCTGCTCGCCGTCACGCAGGACCCAATCTCCGGGATATGCATCTCCCAGAAGGCCGCCAGCATCATGCGCCCCTG
CAAGGTGGAACCCGGTTCCGTCAAGAGCAAGTACAAGGACTACTACTGCGCCAAAGAGGGCAAGGTGGCGCTCATGTCCACGGGCAGCCTGCACCAGCTC
CACATATTCATCTTCGTGCTANCCGTCTTCCATGTCACCTACAGCGTCATCATCATGGCTCTAANCCGTCTCAANATG
page-top