Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20g22
Contig Information
Length 123 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20g22   
Homology (BLAST) Top Hit hypothetical protein OsI_16124 [Oryza sativa Indica Group]
Score 83
Evalue 0.712927
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20g22
ATAACCACTGATAAAACNGCGCAAGCGCANATGANAACTGCTCTGCACTTCTGACACGGCAACTTCCATATTCGCCATGACTGCGTCATCNACACGTGCT
ATGGTTAAGTCAACCGCACCACA
page-top