Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n2m11
Contig Information
Length 767 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n2m11   
Homology (BLAST) Top Hit hypothetical protein OsI_11566 [Oryza sativa Indica Group]
Score 300
Evalue 1.49522e-25
Total Hit Count 24
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n2m11
ACATACTGGCAGATGTTATAGATGAGAGCACAGCATTGGGCCTCTTAAAGTGACTGCTCACCACTTGCAAGTTTCGAATTGTAGGGTTCGTCGCTGCTAA
TCCTAATGTGGCATTCCATTCTACATGAACGGCAAGTCCCAAAACTTTCAGACAACGATGATAGTACAGCATTACACCACAAATTTCCGGCGTATCTCCA
TGCCGCTCACTCGTCAGCGTGCTTCTTCTTTTTCTTCTTCTCCTTCTTGGCAGACACGTCAACCTCCATGGGGGCGTCCTCAGCGTCTGATTTCTTCTTC
TTTTTCTTCTTCTCACCGTCGGTGTTGGCTGCAGGGGTGTCCTCGGCCTCCTTGCTCTTCTTTTTCTTCTTCTTCTCGCTAGCGTCGGTGACGGCTGCTG
GAGTCTCCTCGATGTCCTTGGATTTCTTCTTCTTCTTCTTGGACTTCTCTTTCTCCTGCTCGCCGTCCTGTTCAGCTGCCTCCGCAGTAGGTTCTTCCTC
TTGGTGCTTCCTCTTCTTTGAAGCAACTTCTGACTTCTTTGGCGTTTCTTCAGTGGTTTGTCCAAGCACTANATCTGCTGCTGAGTTGTAAGTTTTAGCG
GGAGTGATCANAGCACCACCACCCTTCCGGTCCTTTTCATACGCTTCTATCTTGGGCTTTCCTTTCNNGGAACCANCANACCTCCCAAGTTCCTTACCCT
CAANAAACTCNAANCCGNGTTTCAAGCTTGAATCCTGCTTTTCAANACCCATGGANNTATCNNCACC
page-top