Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n2o22
Contig Information
Length 722 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n2o22   
Homology (BLAST) Top Hit hypothetical protein OsI_26957 [Oryza sativa Indica Group]
Score 725
Evalue 6.96149e-75
Total Hit Count 413
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n2o22
GATATGCATCTTTCCATGGTGGTTCGGTTCGGCGGTTGTGGCATGACAGGCATCAGTCACAATTACATATGGTTACTTGGCACAAGCTAATAAATAAAAA
AACTGTCCACATTTTGTCTTGTGATCGAAACCAGATTTTTATGCAAACAGCGGCCCGACGACGGGGCATCACAGCTAGCAAAAGGAACAAGGGCCCTAAC
GTTAGCTGCTTCTCAAAAAGTTTCATAGCTGAGAACTCCTTCCTGATCTGCAAAACAGAATCGCTCGGCACCACGGTGTGTAGCTTATATTTTCTTAATG
ATCTGAACAACGTCCTCGTCCTCAAGCTCATGCTCCTTGCCAACTCTCTGAGGCTTATGCTTCACGCTAGAACCCCACACCAGTGCATATTTAAACTGTT
TCGCCATGTCCTTGTGGATTTGGTTGCAGAAGTCTTCCACTGTTTTCCTCTTGGATGATAAGATCACAGGATCCTCGTAGTCTGGGTTCAGCCCTTTGGG
TTTTGTGTATAGCCTGCACAAATCTAGGTATTCCCAGACCATCTCTAGAAGCCCATCAAGGTTCCACTCCAGATGTGCACTAATTGGGCAGTAATGGGGA
AGTTTGTCCAAGATATCCAGCTCTTCAACTGTGATCTGGTCAATTTTGTTGACGACGTANATGCAAGGCATGTANATTCTACTTCCCTCAATGACATCTA
TAAGGNCATCTGCTGTTGCATC
page-top