Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n11k13
Contig Information
Length 795 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n11k13   
Homology (BLAST) Top Hit phosphoglucomutase [Triticum aestivum]
Score 1212
Evalue 2.85897e-131
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whv3n11k13
CACCGCCTCCACCTCCTCGCCTCCTCCTCGACCCCCCGCCCCCTCGCGCGCGCCCACCGGCCCGGCTCCGTGGTCACCGCAGCGGAGATGGTGTTCTCCG
TCACGAAGAAGGAGACCAAGCCCTACGAGGGCCAGAAGCCCGGCACCTCCGGCCTCCGCAAGAAGGTTACAGTATTCCAGCAGCCTCATTACCTCGCGAA
TTTCGTTCAATCAACATTTAATGCCCTTCCAGCTGACCAAGTAAAAGGTGCCACCATTGTTGTCTCCGGCGATGGGCGCTATTTCTCAAAGGATGCTGTT
CAGATCATTGCAAAAATGGCTGCTGCTAATGGAGTAAGACGTGTCTGGGTTGGACAAGACAGTCTCTTGTCAACTCCAGCTGTATCTGCTATCATCCGTG
AAAGAATTTCTGCAGATGGCGCAAAGGCTACTGGTGCCTTCATTTTGACAGCCAGCCACAACCCAGGTGGTCCAACCGAGGACTTTGGAATCAAATACAA
CATGGGGAATGGTGGACCCGCCCCTGAGTCTGTTACCGATAAGATCTTCTCTAATACAAAGACAGTTACTGAATACCTCATTGCGGAGGACCTTCCAAAT
GTTGATATTTCTGTGATAGGTGTCACTTCCTTCACTGGACCTGAAGGCCCTTTTGATGTCGATGTCTTTGACTCTGCTACAGATTACATCAAGCTAATGA
AGACAATCTTTGACTTCGAGTCTATTAAAAAGCTTCTGGCATCTCCAAAGTTCTCGTTCTGTTTTGATGGTCTTCACGGTGTTGCTGGAGCTTAT
page-top