Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n2e01
Contig Information
Length 224 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n2e01   
Homology (BLAST) Top Hit hypothetical protein OsI_21238 [Oryza sativa Indica Group] >gi|125595440|gb|EAZ35499.1| hypothetical protein OsJ_018982 [Oryza sativa (japonica cultivar-group)]
Score 265
Evalue 5.68684e-22
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>whv3n2e01
CNTGTACCACCACCTCGGANACATGGGGCAGCCATCCCTGATATCAGAGTATGACCTGGGAGCAGAAGGCGACCTGTTCAAGGCTCCGGAGCCCATAATC
GAGGAGCCGCTGCTGGCCCTCGACCCGGTCGCCGCCGCCATCTCGATGATGTCCGGCGGGGACAACGCCATGGACGACAGCATCAAGGTCTCCGACATGG
GGCTGAGCGAGGTGCTGTACGAGT
page-top