Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n2o20
Contig Information
Length 625 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n2o20   
Homology (BLAST) Top Hit ice recrystallization inhibition protein 2 precursor [Triticum aestivum]
Score 415
Evalue 4.5031e-39
Total Hit Count 228
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n2o20
ATCGGCCGCAAGCCAGTTGCTGTTTAGTTCAGCGTGGATATAAAACGTTTTGTGGATATTTTAGTAGTAATAGGATTCTATACCCATGAAGTTACAAATA
CGCGATTGGCCCCACCAAGGGATTGTGAACTACACTGAACTTGGACAAGGACATGAGCTCCTCCGGAGAAGAGGGAATTAATCCACTGACAGATCACTAA
CCTCCAGTTACGACTTTGTTATTCCCAGATACGACATGGTTTCTCCCAGATACAACATTATTGCTCCCAGTTACGACATTGTTCCTCCCGGATACGACAT
TGTCGCTCCCAGAAACAACATGGTTTCTCTCAGTCACGACATTGCCACTACCAGATACGACATTGTTACTCCCAGTTACAACATTGTCATTCCCGGATAT
GACAGTGTTGTCATTCCCAGATAGAACATTGTTGGTCCCAGATCTGATAGTGTTGCGGCTTCCAGATATGACATTTGGTTGTTGGCCGAGAATGCGTCTG
TTACGCTTCTCGTACAAGGGCATGTTAGTGAAAGCCATACCCGGTGAATGCCCCACAACGGTGGCGAGGCCCTTGAGTCNTGTCGAACTCTTCGGTACCT
TGCCAATCATTGAATTATTTGAGAG
page-top