Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n2d21
Contig Information
Length 800 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n2d21   
Homology (BLAST) Top Hit hypothetical protein OsJ_003752 [Oryza sativa (japonica cultivar-group)]
Score 156
Evalue 8.12194e-09
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>whv3n2d21
GCACACCCGCTCCCGTTCCGTAATCTCAGCCTCCGTCCTGATCCGATCCCCAAATCCCTCGCCTCGCCGCGCTCGCCGTCGACCTCGTTCTCTCCGGCAC
CAAATCCTACCTCCGGTGAGGCCGACCCACAAGCAGGGCGTGACAGCGCCCTCTCGTCGTATCTCCCGCCGCCCCTCCTCTCCGCCCGCCGTCGTCCCCG
GTCGCCGGAACCCGACAAGTTGGATATCTAGGCGGCACCGCAGCGTTGCGGCGCCCACCGCGCGGACAGGATGTCTGCGGCGCCAGCCGCGTACCCCACC
AGCCTCCGCGCCGTCGCGTCCGGGAACTCCGAGGCCTCCTTCTTCCCCTGCTCGCACCGCCTCAAGCTCTCCTCCTCGCATCGTTTTAGTAGTAGTAGTA
TTGGTAATCGTAGTAATTGCCTCTGACGTTTGCCTCCCCCTCGTTGCCCACGACCTTCGGTTCGATCTGCTCCTTGTGCTCGTCCTGAGGATTGTCTGGT
TGTGAGGGCTCTGTGTTACATCTCTGCCTTTTGTGTTCGCGCGGGTTTGGTGTCTGTGTCTGTGTTCGATCACCAGGTCCGATCCAGAGCGATTTGGCCT
GTTGGAGGTTGTGATTGCTGTCTCTCCGAGGAAAGAGGAAGTTCTCTTCTGAACTTCGGATTTAGCTTGTGGATGGGCGGACCTTTGGTAGACTGCAGTG
CTGAAGGTGTGAGCANCANCTCATGTCTCANCCGCAGCACCTGTGGGAAAAGCAGGTTTTGAGCACAGCTCTTTGTGNCTCTCCCTGAANATGAAAAGTT
page-top