Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n20h10
Contig Information
Length 777 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n20h10   
Homology (BLAST) Top Hit hypothetical protein OsJ_031200 [Oryza sativa (japonica cultivar-group)]
Score 446
Evalue 1.80096e-42
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n20h10
TAAGATTAGCTTACACACTAGGCAATTTTACTTTACTTGCTTTTACACACAAAATCGCAAGCACACTCAGCCGAAGCAACAAGATGCCAACCAAGTTCTC
TAGGGGGGAATGCCAAAATTCGACAACGATAGCCCGTCATGTCGTCTGGTCCACGCCGAAGCCATAGATAGGGGGGAATAAATATGTCAACTGCTCTTCT
CCCGTCATGTCGTCTGGTCCATGCCGAAGCCATAGATCGGGGCGGAATGAATATGTCAACTGCTCTTCTCCACCAGTAAAGCACTAGTACTGTTTGCTCA
TCCTTCTGCTTCTATGATGAAGGCCCTGCTTGGTGGAGCTCCAAATTCCGAAGGACGATCCGTGCGAAGATTTTCGCTTCGATGGGAGCTGTTGCCGCGG
CTGCTGCCCACCGTAAGACCCGGGATGCCCCGGCTTTCTGAAGTAGGGCTGCATGGTGCACAGCATGTCGACCCGCCGGCATAGTGAACTGAAGCAGAGC
AAAAGCTGCACAAGCACGAAGAACAGATGAGGGATTCCGAAGCGTGTCGACAAATCTAGCAATCTCAGCTCGGCTGCATCTAAGATGTCCAGCTTCTTGT
ATAAAAAGTGCGTCAGCAACCTGAGATAAGGCTGCTGCGCCTGAGGATGAAGCAGCCGTAGAAAACATTTGTGGATCTGAAAAGGTCAACACAAAGGCTT
CTATATGCTTAAATGCCAACCTTCTTGCTCCCTCAAATTTTACAATTTTGGAACTACCCTGTGAGGATGTCCCAACC
page-top