Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n2d09
Contig Information
Length 725 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n2d09   
Homology (BLAST) Top Hit RecName: Full=Inositol-3-phosphate synthase; AltName: Full=Myo-inositol-1-phosphate synthase; Short=MI-1-P synthase; Short=IPS >gi|3152731|gb|AAC17133.1| myo-inositol 1-phosphate synthase [Hordeum vulgare subsp. vulgare]
Score 1106
Evalue 4.64723e-119
Total Hit Count 282
Registered year 2003
Contig Sequence     [ Download ]
>whv3n2d09
CCGCACTCGAAAACCTCTCTCTCTCTCACTCCAACAGTTTGCAGGAAAGAGAGGGAGAGATCGATCTTGCGTTGCCAAGATGTTCATCGAGAGCTTCCGC
GTGGAGAGCCCGAACGTGCGGTACGGCGCGGGGGAGATCGAGTCGGAGTACCGCTACGACACCACGGAGCTGGTGCACGAGAGCCACGACGGCGCCTCCA
AGTGGGTCGTCCGCCCCAAGTCCGTCAACTACCACTTCAAGACCAACACCACCGTCCCCAAGCTCGGGGTGATGCTCGTGGGGTGGGGCGGCAACAATGG
CTCCACACTCATGGCTGGGGTCATCGCCAACAGGGAGGGGATCTCATGGGCGACCAAGGACAAGGTGCAGCAGGCCAACTACTTTGGGTCCCTCACCCAG
GCCTCCACCATCAGGGTCGGGAGCTACAACGGAGAGGAGATCTATGCGCCCTTCAAGAGCCTCCTGCCCATGGTAAACCCAGATGATCTTGTGTTTGGTG
GCTGGGACATTAGCAGCATGAACCTGGCTGATGCTATGACCAGGGCCAAGGTGCTGGACATTGACCTGCAGAAGCAGCTCAGGCCCTACATGGAGTCCAT
CGTGCCGCTCCCCGGCATCTATGACCCGGACTTCATCGCTGCCAACCAGGGCTCCCGGGCTAACAATGTCATCAAGGGCACAAAGAAAGAGCAGATGGAG
CAGATTATCAAAGACATAAGGGAGT
page-top