Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n2c22
Contig Information
Length 473 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n2c22   
Homology (BLAST) Top Hit hypothetical protein OsI_34994 [Oryza sativa Indica Group]
Score 230
Evalue 6.41751e-18
Total Hit Count 78
Registered year 2003
Contig Sequence     [ Download ]
>whv3n2c22
ACGTTAATGTCTTTGTTCAAGTCTGTTGCTCCAGCTGGGGCAGGTGTTCTATTCTCGTGGGCACAGAAGCGACAGCATGCAGCGTTCTTTCCAGGTGATC
AGATGGTGTTCCTTCTACTGAACGTGACAGAGGTCCTTGGGCTCTTGCTGACCTTCAAGCCTTTCCTGGCAGTCCCACAACACTACAAGTAAAACCTGAC
AGAGTACCTGTTTAGGTAGTGCTATATAGAGCAATGCGTGTGGTTGTGTGGCACTGGCATGCTGTAAGAGTGAAGACTGAAGAGTCTTCTCTTGTTGTAC
TTGTAGATAGATGTAGCAGTGTTGTTGGCACTGTGACCTAAAGCAATCGATCGGTCGGCCAATCGGGCCATCGATTGCAGTCTTGTATTGCTCCGTCGCT
CTCCTAACCTATGTGTAGTACGTAGTAAGGAGGAATAGAGGTAATCTGAATCTTTCAGTTTCTAAAAAAAAAA
page-top