Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n2b22
Contig Information
Length 738 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n2b22   
Homology (BLAST) Top Hit plasma membrane Na+/H+ antiporter [Triticum turgidum subsp. durum]
Score 661
Evalue 1.92046e-67
Total Hit Count 26
Registered year 2003
Contig Sequence     [ Download ]
>whv3n2b22
GATAGACTACTGTTATACTGCTCCCAGTTATCAGGTGGAGGCTAGAGCAAGGGTCATCTTATTTGAAATGAGGAGGCCAGATATAGAATCCGATCTGCAA
AGAAGTGCATCGTTGCTTTCTCCAGCACTCGGACCGTCACGAACACAGAGCAAAGAGCATGTCGGTTTGCTCAGGTGGCCGGAGAGTTTCCGGAAATCCA
GAGGGCCTGGAAATGCAAGCTTAGCTGAAATCAGAAGCCAGTCTGGTAGCTTCTCTGCTAGAGCCTTGCAAGTCAGCATGTATGGCAGCATGATGGATGG
CATGCGCCCTGCTCGGCGGCAACCGAGGCTTGATCATGTGGAAGCGAACCAGAAGCACAGCGCGTCGTATCCAAAGGTGCCTTCAAGGGCAGCCGACACG
CGGCCTCTGCTGTCGGTGAGGTCGGAGGGCTCCAATGCGGTGAGCAGAAAATCTGCTCCTGCTCCAGCTATAGCTCCTCCACTCGCTTCCTTTCTGCCAC
CCCTAGCAGCAGGACGGCAACGCCGAGCGGTAGGAGAAGATGACGACTCGAGCGATGAGTCCGTGGGGGAAGAAGTTATCGTCAGAGTGGACTCTCCCAN
CATGCTCTCGTTCAATCCACCCTCCGGCCCACCGCNAGGCAGCTGACGGTTGCAGTATGTACCGATATTTTCTTCTTGTTGTATAATAAATTTTGTGACC
AATGGTACCATGGNGTATGTATATCTGTATATGTGTAA
page-top