Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n11j22
Contig Information
Length 698 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n11j22   
Homology (BLAST) Top Hit RecName: Full=Sedoheptulose-1,7-bisphosphatase, chloroplastic; AltName: Full=SED(1,7)P2ase; AltName: Full=Sedoheptulose bisphosphatase; Short=SBPase; Flags: Precursor >gi|14265|emb|CAA46507.1| sedoheptulose-1,7-bisphosphatase [Triticum aestivum]
Score 1141
Evalue 3.72941e-123
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whv3n11j22
CCGGCGGGGAGGCAGTCCAAGGCGGCGAGCCGGGCGGCGCTCACCACCCGGTGCGCGATCGGCGACAGCCTGGAGGAGTTCTTGACCAAGGCGACGCCGG
ACAAGAACCTCATCAGGCTGCTGATCTGCATGGGGGAGGCGATGAGGACGATCGCCTTCAAGGTCAGGACGGCGTCCTGCGGCGGCACGGCCTGCGTCAA
CTCCTTCGGCGACGAGCAGCTCGCCGTCGACATGCTCGCCGACAAGCTCCTCTTCGAGGCGTTGGAGTACTCCCATGTCTGCAAGTACGCGTGCTCTGAG
GAAGTCCCCGAGCTGCAGGACATGGGTGGCCCGGTCGAAGGTGGATTCAGTGTGGCGTTCGACCCCCTTGATGGTTCCAGCATTGTGGACACCAACTTCA
CCGTCGGAACCATCTTCGGTGTCTGGCCCGGCGATAAGCTGACGGGCGTCACCGGCGGTGACCAAGTTGCTGCTGCCATGGGCATCTACGGCCCTCGCAC
CACTTTCGTTGTTGCCCTCAAGGACTGCCCTGGGACGCACGAATTCCTTCTTCTCNACNAANGTAAATGGCANCATGTCAAGGACACTACAACCATTGGA
NAANGGAANATGTTCTCCCCTGGTAACTTGAGGGCCACATTTGATAACCCTGATTACNACAANCTTGTCAACTACTATGTNAAGANAANTACACNCTG
page-top