Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n2b11
Contig Information
Length 795 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n2b11   
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)] >gi|108862503|gb|ABG21971.1| expressed protein [Oryza sativa (japonica cultivar-group)]
Score 1144
Evalue 3.41607e-128
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whv3n2b11
TCTCCTGACCAGTCCAAGATTTCCGAGCTTGTGAATGCCCTCAGAGAGAAACAAATTGGAATTGTGGCCCATTTCTACATGGATCCTGAGGTGCAAGGCA
TACTAACTGCTGCAAAGAGGCAATGGCCCCACATTCACATATCCGACTCATTGGTAATGGCAGATAGTGCTGTTCAGATGGCTGAAGCAGGATGCAAATA
TATTGCTGTGCTAGGTGTTGACTTCATGTCGGAAAATGTCCGTGCAATACTTGATCAAGCAGGATTTACTCAGGTTGGTGTTTATAGAATGTCCAGCGAG
CAAATAGGCTGTTCCTTGGCAGATGCTGCTTCAAGTTCTGCTTATACACATTTTCTTAAGACGGCATCAAGATCTCCTCCTTCTTTACATGTCATTTATA
TCAATACCTCGCTGGAAACAAAAGCTCATACTCATGAACTTGTTCCTACGATAACCTGTACCTCTTCCAATGTTGTTGCAACTATACTACAGGCATTTGC
CGAAATACCAGATCTTAATGTCTGGTATGGTCCTGATTCCTATATGGGTGCGAACATAGCAGACCTATTTAAGAGAATGACTATCATGTCAGATGAAGAG
ATTACAGAGATACATCCAGATCACAACAGGAAAACTATAAGTTCATTATTACAACGTCTTCATTACTATCAGAATGGTAACTGTATTGTGCATGATATGT
TTGGCCATGAAGTTGTGGAAAAAATAAAGGAGGAATACTGTGGATGCATTTCTAACTGCACACTTTGAAGTCCCAGGAGAAATGTTCTCTTTGTC
page-top