Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whv3n2b08
Contig Information
Length 688 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv3n2b08   
Homology (BLAST) Top Hit aspartic proteinase [Triticum aestivum]
Score 635
Evalue 1.17988e-66
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whv3n2b08
GGGTGCGTCTCTTCCTTTCTTTCTTGCTTCTCCCTTTCCCCCTCCTCCTCCTTGACTCCGCCGCCGTCTCACTCGCAACACCCCCGTCTGCTATCTCTTG
GGAGAGGTGGGAGTGGAGGAGGCTAGCCGACGCCGCGACGCAGGCGAGGTTCTTTTGAGTTTCTTTCTGATACCATGGGGCAGAGGCTCCTCTTATTGGT
GACCACTTGTCTGTGGGCTCTTTCATGCGCCGTGCCGCACCATGCTTCCTCGCTTGATGGACTGCTTAGGATCAACCTGAACAAGAGGAGCTTGACCTAT
GAATCTCTGGCCCCGGCAAAGGCAGCGAGGCAGCACGGCGCCCTCCGACTGAAGAGCAGCGATTTAGACAGCGACATCGTGCCTCTTGTCGACTACCTCA
ACACCCAGTACTATGGGGTCATCGGCCTCGGCACGCCGCCGCAGAATTTCACGGTGATATTCGACACCGGGAGCTCCAACCTCTGGGTTCCCTCGTCGAA
ATGCTATTTCTCGATAGCATGCTACCTCCACGCCAAATACAAGTCGAGCAAGTCAAGCACTTACAAAGCAGATGGTGAGACTTGCAAAATTACATATGGC
TCTGGTGCAATCTCTGGATTTTTCAGCAATGATAATGTGTTGGTTGGGGGATCTTGTTGTGAAAAATCAGAAATTCATCGAGACAACA
page-top