Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n2n13
Contig Information
Length 159 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n2n13   
Homology (BLAST) Top Hit glucan endo-1,3-beta-D-glucosidase [Triticum aestivum]
Score 210
Evalue 1.34756e-15
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n2n13
ACGAACCCACTGGCCGACGGCCACCCGCTCTCGGACACGACGACCTTCATCCCCGGTTTGTCCGCGTCCTCCAGCGCGGCATAGATGGAGTCGACCATGG
CGTCNAAGAGGTTCGTGTAGGTCAGGCCGTTGCCGTCGTCGTTCACNGAGGTGCCCGGC
page-top