Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhv3n2o09
Contig Information
Length 732 bp
Tissue Shoot grown under cold condition for 3days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv3n2o09   
Homology (BLAST) Top Hit GSK-like kinase [Triticum aestivum]
Score 729
Evalue 2.45848e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhv3n2o09
ACAATACTGGACCAAATATTGGCGGTACATAGGGTGCATCCTTACTTGCATAGCACATGAGCTCAGGGGAGAACGGTCGAAACACTTCTCATCTACTTAC
AGAATCATGGGTGGCTTTGTTACATCGGCAGTAGGGGGAAAGAATACATGACATCGAGGTCCCGGACGAGAAAAAGAATAATAATCACATGTGTCATCGC
CTATATCCCATGTGGCTGCAGGCAATCTCAAACTCCTGGGGTTTCTAGTAGACGACAATCGGATTTGTTCTGAACTAAACTTCAAGCAGCCGTCTGACGG
ATCACCATCCTACAAAGGCACAGTTCTTCCGAGCATGTTCAGGGATGAGCTTCACCAGGATGTCCATCGGCACGCCCTTCAACTCATGGGGCTTGAAGTT
AAAGAGTGGAGGAAGAAAACGGCCGTTCGGTAAGCGGGTGTTTGGGTCCCGAAGTTCATCGAAGAATGGATGAATTAATGCTTCCAAAGCAGTTGAACGC
AGGCTTGGTGAATATTGCAAGAGTCTGGAGACAAGATCTACTGCTTCAGCAGGCATTCTTTTATGGAAGATCTTGTGCCATGGGTGAGCTTTGATTTGCG
GGAATTTAAACTCANTATAATTTGGATTCATGCACTTAATTTCTTCTCGTGTANGGGTACCTAAAACCTTGATGATTTCAACAAGCTGATCAACACCACT
GTCCCCANGGAATATANGCTGTCCTANAANGA
page-top